Table 2 Genes and primers used in this study
Gene | Product/function | Primer pair (forward/reverse) | Product size | Primer references |
|---|---|---|---|---|
Candidate reference genes | ||||
5.8SrRNA-ITS2 | 5.8S rRNA | atcgaatttttgaacgcacattg/cgcagagaaacctctctttgga | 175 | Hierro et al. [51] |
ACT1 | β-actin [e]/structural protein | gccttctacgtttccatcca/ggccaaatcgattctcaaaa | 153 | Vaudano et al. [34] |
18S | 18S rRNA | tcactacctccctgaattaggattg/agaaacggctaccacatccaa | 72 | Vaudano et al. [34] |
ALG9 | Mannosyltransferase activity/protein amino acid glycosylation | cacggatagtggctttggtgaacaattac/tatgattatctggcagaggaaagaacttggg | 162 | Teste et al. [37] |
TAF10 | RNA Pol II transcription factor activity/transcription initiation and chromatin modification | atattccaggatcaggtcttccgtagc/gtagtcttctcattctgttgatgttgttgttg | 141 | Teste et al. [37] |
TFC1 | RNA Pol III transcription factor activity/transcription initiation on Pol III promoter | gctggcactcatatcttatcgtttcacaatgg/gaacctgctgtcaataccgcctggag | 223 | Teste et al. [37] |
UBC6 | Ubiquitin-protein ligase activity/ER-associated protein catabolic process | gatacttggaatcctggctggtctgtctc/aaagggtcttctgtttcatcacctgtatttgc | 272 | Teste et al. [37] |
Target genes | ||||
ATF1 | Alcohol acetyltransferase Ι/acetate ester biosynthesis | caaggtaatgtgcgatcgtg/acccaaggaaaatgcttgg | 163 | This study |
ATF2 | Alcohol acetyltransferase ΙI/acetate ester biosynthesis | gaggttcgcattacgcctatc/caagttgtaggacccccaga | 153 | This study |
EEB1 | Ethyl ester biosynthesis enzyme/ethyl ester biosynthesis/hydrolysis | accgcattacacacaggtga/agagagcgactgcagcattt | 166 | This study |
EHT1 | Ethanol hexanoyl transferase/ethyl ester biosynthesis/hydrolysis | gaaggatggcctcgtttaca/cactgcgagacaggttttca | 163 | This study |
IAH1 | Isoamyl acetate-hydrolyzing esterase/ester hydrolysis | cccttcgtggctttgaataa/ttgggatgatattgggggta | 158 | This study |
BAT1 | Branched chain amino acid transaminase/deamination of branched chain amino acids | catccaagccaagaccaaat/cacaagcagatgggtcaaga | 147 | This study |
BAT2 | Branched chain amino acid transaminase/deamination of branched chain amino acids | ctggatttaaggcggtcaga/gttggtaaccccttgaagca | 141 | This study |
PDC1 | Puryvate decarboxylase/decarboxylation of α-ketoacids | agctaacgctgctgtcccag/gtggtgaaaccaatggaacc | 195 | This study |
PDC5 | Puryvate decarboxylase/decarboxylation of α-ketoacids | ttctgaaaccactgccatga/ttcaacaacagttctaacaacttcagc | 223 | This study |
PDC6 | Puryvate decarboxylase/decarboxylation of α-ketoacids | caacgacggctacactatcg/ctctgaatcagtggttaaggca | 169 | This study |
ARO10 | Phenylpuryvate decarboxylase/decarboxylation of α-ketoacids | aaccgatcagcaacaattcc/aggccagctgattcaacact | 146 | This study |
THI3 | alpha-ketoisocaproate decarboxylase/decarboxylation of α-ketoacids | agaatttagcatgccgttgc/cgcctacaccaaaggttgtt | 152 | This study |
ADH1 | Alcohol dehydrogenase 1/reduction of aldehydes to higher alcohols | cggtgctgttctaaaggcc/tggacttgacgacttggttg | 179 | This study |
ADH2 | Alcohol dehydrogenase 2/reduction of aldehydes to higher alcohols | tagcgcagtcgttaaggctac/gctctgttccccacgtaaga | 213 | This study |
ADH3 | Alcohol dehydrogenase 3/reduction of aldehydes to higher alcohols | caacattgttcaccaggcgt/aatgcagcttccccttattc | 129 | This study |
ADH4 | Alcohol dehydrogenase 4/reduction of aldehydes to higher alcohols | cagctattggtctctccggta/ccttagcattgtcgtgagca | 189 | This study |
ADH5 | Alcohol dehydrogenase 5/reduction of aldehydes to higher alcohols | ccttcgcaagtcattcctg/atttcaattgaaatggccaatc | 187 | This study |
SFA1 | Class III alcohol dehydrogenase/reduction of aldehydes to higher alcohols | tatcaggctctgatccagaagg/acatttgccacactcagcag | 146 | This study |