Skip to main content

Table 5 Characteristics of 12 URP and the P1 and P2 primers used for amplifying trnL intron

From: In the wild hybridization of annual Datura species as unveiled by morphological and molecular comparisons

No Primers Sequences (5′-3′) GC% content Tm (°C)
1 URP1F ATCCAAGGTCCGAGACAACC 55 65
2 URP2F GTGTGCGATCAGTTGCTGGG 60 67
3 URP2R CCCAGCAACTGATCGCACAC 60 65
4 URP4R AGGACTCGATAACAGGCTCC 55 66
5 URP6R GGCAAGCTGGTGGGAGGTAC 65 65
6 URP9F ATGTGTGCGATCAGTTGCTG 50 67
7 URP13R TACATCGCAAGTGACACAGG 50 68
8 URP17R AATGTGGGCAAGCTGGTGGT 55 74
9 URP25F GATGTGTTCTTGGAGCCTGT 50 65
10 URP30F GGACAAGAAGAGGATGTGGA 50 65
11 URP32F TACACGTCTCGATCTACAGG 50 65
12 URP38F AAGAGGCATTCTACCACCAC 50 65
13 P1 CGAAATCGGTAGACGCTACG 55 63
14 P2 GGGGATAGAGGGACTTGAAC 55 62