Skip to main content

Table 3 Primers used for the amplification and sequencing of 16S rRNA

From: Co-culturing bacteria and microalgae in organic carbon containing medium

Primers Sequences (5′-3′) References
27F AGAGTTTGATCCTGGCTCAG [50]
1492R CGGCTACCTTGTTACGACTT [50]
63F CAGGCCTAACACATGCAAGTC [51]
WBAC2 CCCGGGAACGTATTCACCGCG [51]
E9F GAGTTTGATCCTGGCTCAG [52]
1542R AGAAAGGAGGTGATCCARCC [53]