Table 2 Candidate reference genes were used for the assessment of the expression stability in qPCR analysis
Gene symbol | Accession no. | Name | GO annotation | e-value | Primer sequencec | Amlicon size |
|---|---|---|---|---|---|---|
ACT11 | EE594539.1 | Actin-11 | Structural constituent of cytoskeleton | 1 × 10−66 | GTATGGCAACATTGTCCTCAG TGGAGCAACGACCTTGAT | 118 |
U2SURP | EE594692.1 | U2snRNP-associated SURP motif-containing protein-like | RNA binding, required for spliceosome assembly to participate in splicing | 3 × 10−55 | CGTGGATGAGATTGAGAGGAA TGGAGGACTACGGCTTCTA | 199 |
EF1A | EE594715.1 | Elongation factor-1 alpha | Translation elongation factor activity | 1 × 10−04 | TGCTGTCGGTGTCATCAA CTTCCATCAAACGCCTCATT | 97 |
UBQ | EE594598.1 | Ubiquitin-like protein | Biologically significant role in protein delivery to proteasomes and recruitment of proteasomes to transcription sites. | 9 × 10−19 | CTTGGTCTGCTGTTGTCTTG CACGGTTCACTTATCCATCAC | 200 |
TUB | EE594551.1 | Beta-tubulin chain-like | Microtubule-based process and structural constituent of cytoskeleton | 5 × 10−20 | TGCTGCCTGCTGTATCTT CGGAGGAACTTACTACTACATACT | 109 |
eIF3 | Jk671263 | Eukaryotic translation initiation factor 3 subunit B-like | Translation initiation factor activity | 1 × 10−90 | CCGCCATCGCTACTGTCTCC CCTCTTGCGCTCCTGTTCACT | 126 |
GTF | JZ191082.1 | General transcription factor 3C polypeptide | Involved in RNA polymerase III-mediated transcription | 8 × 10−39 | TTCCAAGTGGCCATCAGGTT AAAGGGCTTCCTGCCTCTTG | 108 |
RPS12 | JZ191056.1 | 40S ribosomal protein S12-like | Structural constituent of ribosome involved in RNA methylation, photorespiration, translation | 1 × 10−91 | TTGGCAGACTCACGAAGG GATGGCGGATCAGGAGAC | 147 |
GAPDH | JN604531.1 | glyceraldehyde-3-phosphate dehydrogenase | Dehydrogenase, Oxidoreductase in glycolysis and gluconeogenesis | 0.0 | TGGGCAAGATTAAGATCGGAAT TTGATGTCGCTGTGCTTCCA | 184 |
RPS3 | JZ191044.1 | 40S ribosomal protein S3-like | Structural constituent of ribosome involved in RNA methylation, photorespiration, translation | 2 × 10−59 | ATTCACTGGCTGACCGGATG GTGCCAAGGGTTGTGAGGTC | 107 |