Skip to main content

Table 4 Primers used in PCR experiments

From: Evaluation of a simple method for storage of blood samples that enables isolation of circulating tumor cells 96 h after sample collection

Gene Forward primer (5′–3′) Reverse primer (5′–3′)
18S rRNA TGCCCTATCAACTTTCGATGGTAGTC TTGGATGTGGTAGCCGTTTCTCA
28S rRNA CGGGTAAACGGCGGGAGTAAC TGGCTGTGGTTTCGCTGGATAG
ACTB GCCCTGGACTTCGAGCAAGAGA CAGGAAGGAAGGCTGGAAGAGTG
NANOG CGTGTGAAGATGAGTGAAACTG GGATGGGCATCATGGAAA
POU5F1 AGGAAGCTGACAACAATG ACTCGGTTCTCGATACTG
CD34 CCCATGCTGGAGGTGACATCTC CCAGGGAGCCGAATGTGTAAAG
NES GAGACACCTGTGCCAGCCTTTCTTA CTGGGCTCTGATCTCTGCATCTACAG
SOX2 CTCGCCCACCTACAGCAT GCTGGCCTCGGACTTGAC
cFOS CCTTCACCCTGCCTCTCCTCAAT GCCTGGATGATGCTGGGAACA
cJUN CCAACTCATGCTAACGCAGCAGTT ACCCTTGGCTTTAGTTCTCGGACAC
cMET AACAGGTGCAAAGCTGCCAGTG GCACGCCAAAGGACCACACAT
DHFR AGTCAGCGAGCAGGTTCTCATTGA TGGACTATGTTCCGCCCACACA
EGFR CCCCTGACTCCGTCCAGTATTGA CTTTTCCTCCAGAGCCCGACTC
ERCC1 GCTACCACAACCTGCACCCAGACT GCAGTCGGCCAGGATACACATCT
EPCAM ACTGCTGGGGTCAGAAGAACAGAC TCTGAAGTGCAGTCCGCAAACTT
PECAM1 GGTCAGCAGCATCGTGGTCAAC GGATGGAGCAGGACAGGTTCAGT
CDH2 CGTGAAGGTTTGCCAGTGTGACTC TTATCCCGGCGTTTCATCCATAC
KRT19 AGCGGCTCATGGACATCAAGTC AGGACAGCAGAAGCCCCAGAG
  1. The above table presents the sequence of the primers used in the present study. The primers are presented in 5′ to 3′ sequence