Skip to main content

Table 2 Genes and primers used in this study

From: Comparative transcriptional analysis of flavour-biosynthetic genes of a native Saccharomyces cerevisiae strain fermenting in its natural must environment, vs. a commercial strain and correlation of the genes’ activities with the produced flavour compounds

Gene Product/function Primer pair (forward/reverse) Product size Primer references
Candidate reference genes
 5.8SrRNA-ITS2 5.8S rRNA atcgaatttttgaacgcacattg/cgcagagaaacctctctttgga 175 Hierro et al. [51]
 ACT1 β-actin [e]/structural protein gccttctacgtttccatcca/ggccaaatcgattctcaaaa 153 Vaudano et al. [34]
 18S 18S rRNA tcactacctccctgaattaggattg/agaaacggctaccacatccaa 72 Vaudano et al. [34]
 ALG9 Mannosyltransferase activity/protein amino acid glycosylation cacggatagtggctttggtgaacaattac/tatgattatctggcagaggaaagaacttggg 162 Teste et al. [37]
 TAF10 RNA Pol II transcription factor activity/transcription initiation and
chromatin modification
atattccaggatcaggtcttccgtagc/gtagtcttctcattctgttgatgttgttgttg 141 Teste et al. [37]
 TFC1 RNA Pol III transcription factor activity/transcription initiation on Pol III promoter gctggcactcatatcttatcgtttcacaatgg/gaacctgctgtcaataccgcctggag 223 Teste et al. [37]
 UBC6 Ubiquitin-protein ligase activity/ER-associated protein catabolic process gatacttggaatcctggctggtctgtctc/aaagggtcttctgtttcatcacctgtatttgc 272 Teste et al. [37]
Target genes
 ATF1 Alcohol acetyltransferase Ι/acetate ester biosynthesis caaggtaatgtgcgatcgtg/acccaaggaaaatgcttgg 163 This study
 ATF2 Alcohol acetyltransferase ΙI/acetate ester biosynthesis gaggttcgcattacgcctatc/caagttgtaggacccccaga 153 This study
 EEB1 Ethyl ester biosynthesis enzyme/ethyl ester biosynthesis/hydrolysis accgcattacacacaggtga/agagagcgactgcagcattt 166 This study
 EHT1 Ethanol hexanoyl transferase/ethyl ester biosynthesis/hydrolysis gaaggatggcctcgtttaca/cactgcgagacaggttttca 163 This study
 IAH1 Isoamyl acetate-hydrolyzing esterase/ester hydrolysis cccttcgtggctttgaataa/ttgggatgatattgggggta 158 This study
 BAT1 Branched chain amino acid transaminase/deamination of branched chain amino acids catccaagccaagaccaaat/cacaagcagatgggtcaaga 147 This study
 BAT2 Branched chain amino acid transaminase/deamination of branched chain amino acids ctggatttaaggcggtcaga/gttggtaaccccttgaagca 141 This study
 PDC1 Puryvate decarboxylase/decarboxylation of α-ketoacids agctaacgctgctgtcccag/gtggtgaaaccaatggaacc 195 This study
 PDC5 Puryvate decarboxylase/decarboxylation of α-ketoacids ttctgaaaccactgccatga/ttcaacaacagttctaacaacttcagc 223 This study
 PDC6 Puryvate decarboxylase/decarboxylation of α-ketoacids caacgacggctacactatcg/ctctgaatcagtggttaaggca 169 This study
 ARO10 Phenylpuryvate decarboxylase/decarboxylation of α-ketoacids aaccgatcagcaacaattcc/aggccagctgattcaacact 146 This study
 THI3 alpha-ketoisocaproate decarboxylase/decarboxylation of α-ketoacids agaatttagcatgccgttgc/cgcctacaccaaaggttgtt 152 This study
 ADH1 Alcohol dehydrogenase 1/reduction of aldehydes to higher alcohols cggtgctgttctaaaggcc/tggacttgacgacttggttg 179 This study
 ADH2 Alcohol dehydrogenase 2/reduction of aldehydes to higher alcohols tagcgcagtcgttaaggctac/gctctgttccccacgtaaga 213 This study
 ADH3 Alcohol dehydrogenase 3/reduction of aldehydes to higher alcohols caacattgttcaccaggcgt/aatgcagcttccccttattc 129 This study
 ADH4 Alcohol dehydrogenase 4/reduction of aldehydes to higher alcohols cagctattggtctctccggta/ccttagcattgtcgtgagca 189 This study
 ADH5 Alcohol dehydrogenase 5/reduction of aldehydes to higher alcohols ccttcgcaagtcattcctg/atttcaattgaaatggccaatc 187 This study
 SFA1 Class III alcohol dehydrogenase/reduction of aldehydes to higher alcohols tatcaggctctgatccagaagg/acatttgccacactcagcag 146 This study