Skip to main content

Table 3 miRNA targets of breast cancer related genes

From: Genome-scale meta-analysis of breast cancer datasets identifies promising targets for drug development

Uniprot id Gene symbol miRNA Target score Total miRNA hits Structure of predicted duplex
NCOA1_HUMAN NCOA1 hsa-miR-650 99 205 AGGAGGCAGCGCUCUCAGGAC
ID4_HUMAN ID4 hsa-miR-203a-3p 98 191 GUGAAAUGUUUAGGACCACUAG
RHEB_HUMAN RHEB hsa-miR-4520-3p 96 74 UUGGACAGAAAACACGCAGGAA
ANXA1_HUMAN ANXA1 hsa-miR-1185-1-3p 93 41 AUAUACAGGGGGAGACUCUUAU
PDZ1I_HUMAN PDZK1 hsa-miR-15b-3p 92 41 CGAAUCAUUAUUUGCUGCUCUA
UPAR_HUMAN PLAUR hsa-miR-942-5p 92 43 UCUUCUCUGUUUUGGCCAUGUG
Q1KXY7_HUMAN AKR1C2 hsa-miR-185-5p 90 108 UGGAGAGAAAGGCAGUUCCUGA
SLPI_HUMAN SLPI hsa-miR-3173-3p 72 8 AAAGGAGGAAAUAGGCAGGCCA