Skip to main content

Table 1 Primer sequence, product size, location and annealing temperature of α1-AT gene in Chinese Holstein cows

From: Two single nucleotide polymorphisms sites in α1-AT gene and their association with somatic cell score in Chinese Holstein cows

Primer Primer sequence (5′ → 3′) Product size (bp) Locationa Annealing temperature (°C)
P1 F: GCCATTGTTCTGAGTCTTTC 978 5216–5235 54
R: TTCCCTAACCCTATTTGATT 6174–6193
P2 F: GGCACCAACTGGAAAGAACAAC 175 8060–8081 59
R: AGCCCTATCGCTGAAGACCT 8215–8234
P3 F: CCTTTGCGATGCTCTCCCTG 149 5616–5635 55
R: CTGGTGGTTTGGCTGATT 5747–5764
  1. aBase positions corresponding to NC_007319 of GenBank