Skip to main content

Table 3 PCR primers used in the analyses of green-algae strains isolated from freshwaters of Greece

From: Polyphasic taxonomy of green algae strains isolated from Mediterranean freshwaters

Primer Target gene-region Sequence (5′–3′) Size (bp) References Conditions
EukA 18S rRNA AACCTGGTTGATCCTGCCAGT 1750 [78] Initial denaturation step at 95 °C for 5 min, 35 cycles consisting of denaturation at 95 °C for 60 s, annealing at 55 °C for 60 s and elongation at 72 °C for 90 s; a final 7-min elongation step at 72 °C was included
EukB TGATCCTTCTGCAGGTTCACCTAC
U1391R GGGCGGTGTGTACAARGR [79]
ITS-AF ITS CGTTTCCGTAGGTGAACCTGC 700 [80] Initial denaturation step at 94 °C for 4 min, 35 cycles consisting of denaturation at 95 °C for 60 s, annealing at 58 °C for 2 min and elongation at 72 °C for 2 min; a final 7-min elongation step at 72 °C was included
ITS-BR CATATGCTTAAGTTCAGCGGG T
rbcL1-20 rbcL ATGGTTCCACAAACAGAAAC 1100 [81]
rbcL1181-1160 AAGATTTCAACTAAAGCTGGCA