Skip to main content

Table 4 Primers used for gene expression analysis

From: Effect of crocin on antioxidant gene expression, fibrinolytic parameters, redox status and blood biochemistry in nicotinamide-streptozotocin-induced diabetic rats

PrimerSequence (5ʹ–3ʹ)Amplicon size (bp)
ΡΑΙ-1-F
ΡΑΙ-1-R
ATCAACGACTGGGTGGAGAG
GAAATAGAGGGCGTTCACCA
108
SOD1-F
SOD1-R
GGTGAACCAGTTGTGGTGTCAGG
ATGAGGTCCTGCAGTGGTACAG
114
SOD2-F
SOD2-R
TAACGCGCAGATCATGCAGCTG
AGGCTGAAGAGCAACCTGAGTT
133
CAT-F
CAT-R
CTTCATCAGGGATGCCATGT
CGGTCGCTGAACAAGAAAGT
150
GAPDH-F
GAPDH-R
CATCACTGCCACTCAGAAGACTG
ATGCCAGTGAGCTTCCCGTTCAG
153