Skip to main content

Table 1 Primers for Real-time PCR

From: Evaluating the effect of TLR4-overexpressing on the transcriptome profile in ovine peripheral blood mononuclear cells

Gene Forward primer sequence (5΄-3΄) Reverse primer sequence (5΄-3΄)
MSR1 CGATGCTCGCTCAATGACA AATGATGGGCACGAGAACTACA
OLR1 CTGCTTGTCTTTGGACGCC AGCCACGAGTAGCTGGGTT
NFKB1 TGGCAGCTCTTCTCAAAGCA GACCCCTTCATCCTCTCCATC
CD14 TGGACCTCAGCCACAACTCG AGCCCAGCGAACGACAAAT
MYD88 CGGATGGTGGTGGTTGTCT GGAACTCTTTCTTCATTGGCTTG
TLR4 GGGTGCGGAATGAACTGGT GATGATATTGGCGGCGATG
ICAM1 ACCCTCATCTTGGGCACTC GGCGGCGTGGATTTCA
β-actin AGATGTGGATCAGCAAGCAG CCAATCTCATCTGCTTTTCTG