Skip to main content

Table 1 The primer sequences used for qRT-PCR

From: CircCNIH4 inhibits gastric cancer progression via regulating DKK2 and FRZB expression and Wnt/β-catenin pathway

Gene Sequence (5′ to 3′)
circCNIH4 F: GAGGGCAGCTGAAGTCACAC
R: ACCAGTGCAATGACATGAGC
CNIH4 F: TCAACTTACCTGTTGCCACTTG
R: TCTGTTGGATCAAACACTCCCA
SFRP1 F: ACGTGGGCTACAAGAAGATGG
R: CAGCGACACGGGTAGATGG
SFRP2 F: ACGGCATCGAATACCAGAACA
R: CTCGTCTAGGTCATCGAGGCA
SFRP4 F: CCTGGAACATCACGCGGAT
R: CGGCTTGATAGGGTCGTGC
DKK1 F: GTGCAAATCTGTCTCGCCTG
R: GCACAACACAATCCTGAGGC
DKK2 F: GATGATCCTTGGTGGGGAC
R: GTACCAAGGACTGGCATTCG
DKK4 F: TGGACTTCAACAACATCAGGAG
R: GGTATTGCAGTCCGTGTCAG
IDAX F: CTCATCAACTGTGGCGTCTG
R: TTAGTTTGCCCTTCATTTCC
FRZB F: ACGGGACACTGTCAACCTCT
R: CGAGTCGATCCTTCCACTTC
U6 F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCGT
GAPDH F: ACAACTTTGGTATCGTGGAAGG
R: GCCATCACGCCACAGTTTC